How to run

Kaptive's main function is in silico serotyping via kaptive type.

Basic usage is outlined below and full instructions, including all command line options, are detailed on the CLI Usage pages.

Inputs¶

Kaptive performs in silico serotyping on bacterial whole genome assemblies. Your input genome assemblies should be in FASTA format (they can be gzip-compressed), with one assembly per file.

1
2
3
4

  >contig1
  ATGAAAAAATGCGCGTATGACT
  >contig2
  TTCGACTCCTGACTGACTGACTTTTATTT

Go serotyping!¶

Once you have installed Kaptive and your chosen database, you are ready to serotype.

To run Kaptive on your assemblies you can run:

1

kaptive type kpsc_k -o results.tsv *.fasta 

This assumes your input files have the .fasta file extenion and are avialable in the current directory.
Kaptive will run on each assembly and print the output to a tab-delimted file called results.tsv.
kpsc_k is the database keyword, and points to the Klebsiella pneumoniae Species Complex K database. For a full list of supported key words see here. You can also run Kaptive on a custom database by following these instructions.

Outputs¶

Tabular¶

The main output of the assembly typing mode is a tab-delimited table of the results. See here for tips on interpreting these results. For full explanation of the column content see here.

The default is to print this table to stdout. You can use UNIX redirection operators (> or >>) or the -o/--out flag to write to a file.

If the summary table already exists and is not empty, Kaptive will append to it (not overwrite it) and suppress the header line. This allows you to run Kaptive in succession on sets of assemblies, all outputting to the same table file.

To disable the tabular output, simply redirect the output to /dev/null.

Locus sequences¶

The -l/--loci flag produces a fasta file of the region(s) of the assembly which correspond to the best locus match. This may be a single piece (in cases of a good assembly and a strong match) or it may be in multiple pieces (in cases of poor assembly and/or a novel locus).

You can specify either a directory, which will write one file per assembly named as {assembly}_kaptive_results.fna, or a single file ("-" for stdout), which will write all the sequences to that file.

For example:

1

    kaptive type kpsc_k assembly.fasta -l

This results in default behaviour which will produce one file per assembly in the current directory. However, to specify a directory:

1

    kaptive type kpsc_k assembly.fasta -l kaptive_results/

1
2

    kaptive type kpsc_k assembly.fasta -l kaptive_results.fna
    kaptive type kpsc_k assembly.fasta -l - > kaptive_results.fna

Locus plots¶

Kaptive can generate interative plots showing the locus pieces and genes present in your input assemblies.

1

    kaptive type kpsc_k *.fasta --plots my_plot_directory

If no directory is specified, Kaptive will generate the plots in the current directory.

PHA4GE genotyping spec¶

The Public Health Alliance for Genomic Epidemiology has developed the PHA4GE Microbial Genotyping Data Specification, which represents a standardised format for communicating genotyping methods and results. Kaptive can optionally output results in this format:

1

    kaptive type kpsc_k *.fasta --pha4ge my_pha4ge_table.tsv

JSON¶

The -j/--json flag produces a JSON file of the results which allows Kaptive to reconstruct the TypingResult objects after a run which can be used with kaptive-convert. Unlike previous version (2 and below), this is a JSON lines file (or "-" for stdout), where each line is a JSON object representing the results for a single assembly. If the file already exists, Kaptive will append to it (not overwrite it).

The default is to write this file to: kaptive_results.json, however the path can be specified after the flag, for example:

1

kaptive assembly kpsc_k assembly.fasta -j kaptive_results.json

Comments